|
Synthego Inc
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/non+targeting+nt+control+sgrna/pm40769148-750-28-35?v=Synthego+Inc Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
GenScript corporation
sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence ![]() Sgrna (Small Guide Rna) To Knocking Out Bmal2 As Well As Non Targeting (Nt) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/non+targeting+nt+control+sgrna/pmc10055246-164-1-16?v=GenScript+corporation Average 90 stars, based on 1 article reviews
sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Ras-dependent activation of BMAL2 regulates hypoxic metabolism in pancreatic cancer
doi: 10.1101/2023.03.19.533333
Figure Lengend Snippet: ( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly by BMAL2 (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting sgRNA in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,
Article Snippet: The
Techniques: Control, Expressing, Derivative Assay, Migration, Incubation, Western Blot